Table 2

Shown are examples of liver-specific genes that contain a regulatory element with a HNF-3 binding site. The species of the investigated gene with its regulatory sequence as well as the respective references are indicated. The positions of the HNF-3 binding sites have preferably been taken from published DNase I footprinting studies, if available. The next preference is for chemical modifications, and the last for gel retardation assays. In case of different positional information for both DNA strands, the more upstream position has been taken for the 5′-border and the more downstream position for the 3′-border of the site. If not stated otherwise, the position numbers generally refer to the transcription start site (t.s.s.). Occasionally they may refer to the translation start codon stated as ATG or to a defined restriction site. When the authors emphasize a specific motif within the published regulatory sequence it is written in capitals whereas the rest of the sequence is written in lowercase letters. → indicates a continuing sequence in the next line.

HNF-3 Binding Sites
Gene	Regulatory Element	Gene Region	Position of Binding Site	First Position	Species	Reference
Albumin	GTTTGTTCTT	Element eG	528 to 547	NheI at −11.4 kb	M. musculus	Liu et al., 1991
Aldolase B	CAGAGTTATTGAATAAACACCTC		−126 to −104	t.s.s.	R. norvegicus	Gregori et al., 1993; Tsutsumi et al., 1989
α1-Antitrypsin	AATATTGACTTTG	5′-Region	−378 to −366	t.s.s.	M. musculus	Samadani and Costa, 1996
α-Fetoprotein	caAAGTCAATAAag	5′-Region	−6103 to −6090	t.s.s.	R. norvegicus	Lannoy et al., 1998; Samadani et al., 1996
α2-Macroglobulin	GGTATTGACTTTA	5′-Region	−452 to −442	t.s.s.	R. norvegicus	Samadani and Costa, 1996
Alkaline phosphatase	gaTGTTTgttct		−953 to −942	ATG	H. sapiens	Ye et al., 1997
Apolipoprotein B	CTGTCCTGTTTATCAGTGACTAGTCATT	Intron 2, enhancer, element E	839 to 935	t.s.s.	H. sapiens	Brooks et al., 1991
	→ATTCGAAGCATGTGAGGGTGAGGAAA
	→TACTGACTTTAACCTTTGTGAAGAAAT
			892 to 904			Samadani and Costa, 1996
	→CGAACCTCCACCCCC
Insulin-like growth factor binding protein 1	TcacaagcaAAACAAActtattttgaacacgg	IRS (insulin responsive sequence)	−168 to −137	t.s.s.	R. norvegicus	Goswami et al., 1994
	cactagCAAAACAaactTATTTTGaacac		−124 to −96		H. sapiens	O'Brien et al., 1995
Phosphoenol-pyruvate carboxykinase	GtgacacctcacagctgTGGTGTTTTGacaaccagcag	IRS (insulin-responsive sequence)	−433 to −396	t.s.s.	R. norvegicus	O'Brien et al., 1995; Wang et al., 1996
	TGGTGTTTTGACAAC		−416 to −402
6-Phosphofructo-2-kinase/fructose-2,6-bisphosphatase	GTCTTTTATTTGCATACTCA	Promoter, site III	−132 to 112	t.s.s.	R. norvegicus	Lemaigre et al., 1993
Protein C	agggccAAGCAAATATTTGTGGttatgga		−43 to −15	t.s.s.	H. sapiens	Spek et al., 1995
Transferrin	AATCTACAAGTGTTTGCAGCATAGTCAT	Site A	−306 to −297	t.s.s.	Salmo salar	Stenson et al., 2000
Tryptophan oxygenase	TCTATTGATTTAT	5′-Region	−220 to −208	t.s.s.	R. norvegicus	Samadani and Costa, 1996
TTR (transthyretin, prealbumin)	GtTGACTAAgtcaataatcagaatcag	Element TRE	−111 to −88	t.s.s.	M. musculus	Qian and Costa, 1995
	TATTTGTGTAG	HNF3-W	−140 to −131			Costa and Grayson, 1991
	ctgTTCAAACATGtcCTAATACTCTgtctctgc	TTR-2	32 to 46			Samadani et al., 1996
	CTAAGTCAATAAT	HNF3-S	−111 to −82			Samadani and Costa, 1996
Tyrosine amino transferase	CcggacgtttCTCAATATTTGCTCtggcaga		−10514 to −10484	t.s.s.	R. norvegicus	Nitsch et al., 1993
	GGCCAcaaataaaaga		−5463 to −5448			Grange et al., 1991; Lemaigre et al., 1993; Rigaud et al., 1991
	GCCACAGTTATGCAAAACACAAAACAA		−5399 to −5364
	→TAAG		−5377 to −5345
	CAGTCTGCAAACAGATGAAGATTTT		−5322 to −5291
	ACTTTATTTGCAATAGAAAATC		−2487 to −2465
	TAGAACAAACAAGTCCTGCGT		−2440 to −2414
Vitellogenin A2	TGAGGTAATtgTTTACACAa	AABS element	−124 to −85	t.s.s.	X. laevis	Kaling et al., 1991
Vitellogenin B1	TGTGTGC	Promoter	−58 to −52	t.s.s.	X. laevis	Cardinaux et al., 1994
	TATTTAC	Promoter	−81 to −75
	GCAAACA	Promoter	−125 to −119