Shown are examples of liver-specific genes that contain a regulatory element with a HNF-1 binding site. The species of the investigated gene with its regulatory sequence as well as the respective references are indicated. The positions of the HNF-1 binding sites have preferably been taken from published DNase I footprinting studies, if available. The next preference is for chemical modifications, and the last for gel retardation assays. In case of different positional information for both DNA strands, the more upstream position has been taken for the 5′-border and the more downstream position for the 3′-border of the site. If not stated otherwise, the position numbers generally refer to the transcription start site (t.s.s.). Occasionally they may refer to the translation start codon stated as ATG or to a defined restriction site. When the authors emphasized a specific motif within the published regulatory sequence, it is written in capitals whereas the rest of the sequence is written in lowercase letters. → indicates a continuing sequence in the next line.
HNF-1α Binding Sites | ||||||
---|---|---|---|---|---|---|
Gene | Regulatory Element | Gene Region | Position of Binding Site | First Position | Species | Reference |
Albumin | tGGTTAGtaattactaa | −363 to −338 | Homo sapiens | Liu et al., 1991 | ||
GTTTGTTCTT | Element eG | 528 to 547 | NheI at −11.4 kb | Mus musculus | Frain et al., 1990 | |
Aldolase B | CAGAGTTATTGAATAAACACCTC | −126 to −104 | t.s.s. | Rattus norvegicus | Gregori et al., 1993;Tsutsumi et al., 1989 | |
α1-Antitrypsin | TGGTTAATATTCACCAgc | −86 to −56 | t.s.s. | H. sapiens | De Simone and Cortese, 1991 | |
α-Fetoprotein | TGTTAATTATTGGCAAATTGCCTAACTTC→A | −128 to −99 | t.s.s. | Rattus rattus | Jose-Estanyol and Danan, 1988 | |
α-Fibrinogen | AGGACAAAGCCAAT | Promoter | −67 to −54 | t.s.s. | H. sapiens | Hu et al., 1995 |
Apolipoprotein AII | GATATCTATTTAACTGATTTCACCC | Distal region I, N | −903 to −879 | t.s.s. | H. sapiens | Chambaz et al., 1991; Cardot et al., 1993 |
Apolipoprotein B | GTTTATCAGTGACTAGTCATTGAT | Intron 2, enhancer | 835 to 876 | Cap | H. sapiens | Brooks and Levy-Wilson, 1992 |
β-Fibrinogen | CAAACTGTCAAATATTAACTAAAGGGAG | β28 element | −103 to −75 | t.s.s. | R. norvegicus | Kuo et al., 1991; Xanthopoulos et al., 1991 |
CYP2E1 | TGATAGCCAACTGCAGCTAATAATAAACCA | −127 to −93 | t.s.s. | R. norvegicus | Ueno and Gonzalez, 1990 | |
CRP | TTTGTAATAAATAACTCA | −175 to −133 | t.s.s. | H. sapiens | Majello et al., 1990; Toniatti et al., 1990 | |
CAATGTTGGAAAATTATttacat | −80 to −57 | |||||
Factor VIII | ATATTTTAGAGAAGAATTAACCTTT | Element A | −59 to −35 | ATG | H. sapiens | Figueiredo and Brownlee, 1995 |
IGFBP-1 (insulin-like growth factor binding protein-1) | TGCGGCGCTGCCAATCATTAAC | −79 to −53 | t.s.s. | H. sapiens | Powell et al., 1995 | |
Large surface protein (HBV) | TAGTTAATCATTACTTC | SPI promoter | −93 to −68 | t.s.s. | Human hepatitis B virus | Chang et al., 1989 |
Prothrombin | GTGTTCCTGCTCTTTGTCC | −941 to −920 | t.s.s. | H. sapiens | Chow et al., 1991 | |
Surface antigen (HBV) | GTTAATCATTAC | Pre-S1 promoter | −93 to −69 | t.s.s. | Human hepatitis B virus | Zhou and Yen, 1991 |
Vitellogenin A2 | TGAGGTAATtgTTTACACAa | AABS element | −124 to −85 | t.s.s. | Xenopus laevis | Drewes et al., 1991 |