Shown are examples of liver-specific genes that contain a regulatory element with a HNF-4 binding site. The species of the investigated gene with its regulatory sequence as well as the respective references are indicated. The positions of the HNF-4 binding sites have preferably been taken from published DNase I footprinting studies, if available. The next preference is for chemical modifications, and the last for gel retardation assays. In case of different positional information for both DNA strands, the more upstream position has been taken for the 5′-border and the more downstream position for the 3′-border of the site. If not stated otherwise, the position numbers generally refer to the transcription start site (t.s.s.). Occasionally they may refer to the translation start codon stated as ATG or to a defined restriction site. When the authors emphasized a specific motif within the published regulatory sequence, it is written in capitals whereas the rest of the sequence is written in lowercase letters. → indicates a continuing sequence in the next line.
HNF-4 Binding Sites | ||||||
---|---|---|---|---|---|---|
Gene | Regulatory Element | Gene Region | Position of Binding Site | First Position | Species | Reference |
α1-Antitrypsin | CTCAGATCCCAGCCAGTGGACTTAGCCC | −134 to −98 | t.s.s. | H. sapiens | Monaci et al., 1988 | |
CTGTTTGC | ||||||
Apolipoprotein CIII | TGGGTCCAGAGGGCAAAA | 5′-enhancer, element 1 | −745 to −725 | t.s.s. | H. sapiens | Bisaha et al., 1995 |
CAGGTGACCTTTGCCC | C3P element | −93 to −71 | Mietus-Snyder et al., 1992 | |||
Biliary glycoprotein | CGCCCCAGCACACATGATCAGA | FP1 element | −158 to −137 | t.s.s. | H. sapiens | Hauck et al., 1994 |
Factor VIII | AAGGTTCTGATTAAAGCAGACTTATGCC | Promoter, element E | −311 to −279 | ATG | H. sapiens | Figueiredo and Brownlee, 1995 |
→CCTAC | ||||||
Ornithine transcarbamylase | gttaGATGAACTTTAAACCTTTGtgat | Enhancer, element I | 76 to 102 | HincII | R. norvegicus | Nishiyori et al., 1994; Murakami et al., 1990 |
cagCTTAACCTCTGAACTTCTAagg | Element IV | 161 to 185 | HincII | |||
Transferrin | AACACGGGAGGTCAAAGATTGCGCCC | PR I element | −76 to −48 | t.s.s. | H. sapiens | Schaeffer et al., 1993 |
TTR (transthyretin, prealbumin) | GGCAAGGTTCATatttgtgtag | Element HNF4P | −156 to −130 | t.s.s. | M. musculus | Xanthopoulos et al., 1991 |
TGCAAGGGTCAT | Element HNF4D | −1 to 10 | Sladek et al., 1990 |