Biochemical and Biophysical Research Communications
Direct binding of plectin to Fer kinase and negative regulation of its catalytic activity☆
Section snippets
Materials and methods
Preparation of DNA constructs. Plasmid pMZ4, encoding histidine-tagged rat plectin sequences (exon 12–24), has been described previously [19]. Plasmid pPL2, encoding full length murine Fer with an N-terminal histidine tag, was constructed by amplifying a 500 bp fragment of the plasmid pECE-mufer (provided by Dr. A. J. Pawson) using as upper primer 5′CTTACAGATCTGGATTTGGGAGTGACCTGAAG3′ and 5′TGTTTCCTTCCCTTTCGCTAAGGC3′ as lower primer. The product was digested using BglII and EcoRI and cloned into
The N-terminal domain of Fer interacts directly with plectin
Screening of a mouse cDNA library in the yeast two-hybrid system using the N-terminal domain of murine Fer as bait originally uncovered a fragment of plectin encoded by exons 14–19 as a potential interaction partner of the kinase. To confirm this observation, corresponding fragments were expressed as fusion proteins containing either maltose-binding protein (MBP-Fer) or a his-tag (his-plectin) and assayed for binding in vitro. MBP-Fer containing the first 329 N-terminal amino acids of the Fer
Discussion
Protein–protein interactions between tyrosine kinases and their targets, mediated by specialized protein modules, determine the pathways along which signals are transduced and therefore how their signaling networks are organized. Apart from direct interactions between signaling proteins, interactions between signaling proteins and scaffolding proteins also determine to which targets, and with what signal strength and speed, signals are transduced. In this study, we show that the N-terminal
Acknowledgements
The authors thank Dr. Anthony J. Pawson for the donation of reagents and Mag. Branislav Nikolic for assistance and helpful discussions. This research work was supported by a Marie Curie Fellowship of the European Union programme Training and Mobility of Researchers (TMR) under contract number ERBFMBICT972397 (to P.L.) and a grant from the Austrian Science Research Fund (P14520).
References (34)
- et al.
Growth factor-dependent phosphorylation of the actin-binding protein cortactin is mediated by the cytoplasmic tyrosine kinase FER
J. Biol. Chem.
(1998) - et al.
Disruption of coiled-coil domains in Fer protein-tyrosine kinase abolishes trimerization but not kinase activation
J. Biol. Chem.
(1999) - et al.
A panel of monoclonal antibodies to rat plectin: distinction by epitope mapping and immunoreactivity with different tissues and cell lines
Acta Histochem.
(1994) - et al.
Oligomerization of the Fes tyrosine kinase. Evidence for a coiled-coil domain in the unique N-terminal region
J. Biol. Chem.
(1997) - et al.
Caveolin interaction with protein kinase C. Isoenzyme-dependent regulation of kinase activity by the caveolin scaffolding domain peptide
J. Biol. Chem.
(1997) - et al.
Interaction of a receptor tyrosine kinase, EGF-R, with caveolins. Caveolin binding negatively regulates tyrosine and serine/threonine kinase activities
J. Biol. Chem.
(1997) - et al.
Plectin and IFAP-300K are homologous proteins binding to microtubule-associated proteins 1 and 2 and to the 240-kilodalton subunit of spectrin
J. Biol. Chem.
(1987) Plectin: general overview and appraisal of its potential role as a subunit protein of the cytomatrix
Crit. Rev. Biochem. Mol. Biol.
(1989)- et al.
Defective expression of plectin/HD1 in epidermolysis bullosa simplex with muscular dystrophy
J. Clin. Invest.
(1996) - et al.
Loss of plectin causes epidermolysis bullosa with muscular dystrophy: cDNA cloning and genomic organization
Genes Dev.
(1996)
Plectin deficiency results in muscular dystrophy with epidermolysis bullosa
Nat. Genet.
Targeted inactivation of plectin reveals essential function in maintaining the integrity of skin, muscle, and heart cytoarchitecture
Genes Dev.
Not just scaffolding: plectin regulates actin dynamics in cultured cells
Genes Dev.
Role of plectin in cytoskeleton organization and dynamics
J. Cell Sci.
Plectin: a cytolinker by design
Biol. Chem.
Expression of the mammalian c-fes protein in hematopoietic cells and identification of a distinct fes-related protein
Mol. Cell. Biol.
Nuclear and cytoplasmic location of the FER tyrosine kinase
Mol. Cell. Biol.
Cited by (43)
The spectraplakins of Caenorhabditis elegans: Cytoskeletal crosslinkers and beyond
2017, Seminars in Cell and Developmental BiologyThe structure of the plakin domain of plectin reveals an extended rod-like shape
2016, Journal of Biological ChemistryCitation Excerpt :The SH3 lacks a canonical poly-Pro-binding site and makes extensive contacts with the SR4. The plakin domain of plectin participate in protein-protein interactions harboring binding sites for integrin α6β4 (17), BPAG2 (also known as BP180 or type XVII collagen) (18), β-dystroglycan (10), β-synemin (19), and the kinase Fer (20), although the specific binding sites for these proteins are not known precisely. The plakin domain is present in all plakins except epiplakin.
Networking and anchoring through plectin: A key to IF functionality and mechanotransduction
2015, Current Opinion in Cell BiologyPlakins, a versatile family of cytolinkers: Roles in skin integrity and in human diseases
2014, Journal of Investigative DermatologyCitation Excerpt :Plectin directly or indirectly interacts with several kinases and signaling molecules. Specifically, plectin associates with and modulates the activities of the nonreceptor tyrosine kinase Fer, energy-controlling AMP-activated protein kinase, the protein kinase C receptor RACK1, and β-dystroglycan (Lunter and Wiche, 2002; Osmanagic-Myers and Wiche, 2004; Gregor et al., 2006; Osmanagic-Myers et al., 2006; Rezniczek et al., 2007; Takawira et al., 2011). Thus, plectin affects a variety of processes, such as control of cell adhesion, regulation of protein kinase C signaling, or cellular stress responses.
The structure of the plakin domain of plectin reveals a non-canonical SH3 domain interacting with its fourth spectrin repeat
2011, Journal of Biological ChemistryCitation Excerpt :The plakin domain of plectin and other plakins contain protein-protein interaction sites and they are important for the localization of plakins at junctional complexes. In plectin this region harbors binding sites for the integrin β4 subunit (24), the cytoplasmic domain of BPAG2 (25), β-dystroglycan (13), β-synemin (15), and the tyrosine kinase Fer (26). The central region consists of a coiled-coil rod domain that acts as a structural spacer of the protein-protein binding sites located in the N- and C-terminal regions and mediates homo-dimerization of plectin.
A dystroglycan/plectin scaffold mediates mechanical pathway bifurcation in lung epithelial cells
2011, Journal of Biological ChemistryCitation Excerpt :In lung cells, we have demonstrated that plectin functions as a mechanosignaling scaffold, a finding consistent with other indications that plectin is an important signaling regulator. For example, plectin interacts with the nonreceptor tyrosine kinase Fer and attenuates its catalytic activity (52). Plectin also binds the scaffold for many kinases and receptors called the receptor for activated C kinase 1 (RACK1), thereby reducing the ability of RACK1 to scaffold and participate in signaling (53, 54).
- ☆
Abbreviations: SH2, Src homology 2; MBP, maltose-binding protein; EGFP, enhanced green fluorescent protein; tTA, Tet-responsive transactivator; mAb, monoclonal antibody.