Journal of Molecular Biology
The Death-domain Fold of the ASC PYRIN Domain, Presenting a Basis for PYRIN/PYRIN Recognition
Introduction
The death domain fold is the unifying structural motif of a superfamily of protein domains comprising the death domain (DD) itself,1 the death effector domain (DED)2 and the caspase recruitment domain (CARD).3 Their names express the prominent roles of these domains in programmed cell death. Domains from all three subfamilies occur as modules in diverse human apoptosis proteins in a variety of domain contexts. They all form α-helical bundles acting as adapters in signalling pathways and recruiting other proteins into signalling complexes.4 Domains from the different death domain subfamilies tend to interact with each other, suggesting that their common fold was frequently reused as a module during the evolution of apoptotic adapter proteins, providing the structural backbone of the signalling pathways that control programmed cell death. Commensurate with their biological importance and despite often poor solubility due to self-association, several structures have been determined for DDs,1., 5., 6., 7., 8., 9. DEDs2., 10. and CARDs.3., 11., 12., 13., 14.
The PYRIN domain, also called DAPIN, PAAD or PYD, is a recently identified domain that has been suggested to present a new member of the DD superfamily.15., 16., 17., 18., 19., 20. No experimentally determined structure of a PYRIN domain has been reported to date. An attempt to solve the structure of the PYRIN domain of CARD7 failed due to limited solubility.17
PYRIN domains are located at the N terminus of proteins that are linked intimately to a variety of human diseases, ranging from cancer to inflammatory syndromes.15., 16., 18., 21., 22. The PYRIN domain was originally found in pyrin, the product of the familial Mediterranean fever (FMF)-associated gene, which is involved in a hereditary hyperinflammatory response syndrome,23 and in ASC/TMS1/PYCARD, which functions as a positive mediator of apoptosis.19., 24. Inflammation and apoptosis upregulate ASC in neutrophils and, depending on the cellular context, it can either inhibit or activate NF-κB.25., 26. ASC contains both a PYRIN and a CARD domain. Homophilic and heterophilic interactions of both domains have been reported to be involved in self-association and filament-like aggregation of ASC in vivo.27 ASC and PYRIN seem to interact via their PYRIN domains,19 while the CARD domain of ASC was shown to bind to the CARD domain of caspase-1.24., 28., 29. The PYRIN domain of ASC was further shown to bind to POP1/ASC2, a small protein consisting of a single PYRIN domain with a high level of amino acid sequence similarity to the PYRIN domain of ASC.30 The interaction between ASC and POP1/ASC2 results in a modulation of NF-κB and pro-caspase-1 regulation.30 Finally, there is evidence that ASC and caspase-1, together with NALP1 (another PYRIN-domain protein) and caspase-5, form a pro-apoptotic complex, named inflammasome, which is essential for innate immunity involving LPS-induced apoptosis.31
Two further human hereditary diseases were recently attributed to the PYRIN-domain protein NALP3/CIAS1/PYPAF1, Muckle–Wells syndrome and familial cold autoinflammatory syndrome.22., 32., 33. CIAS1 assembles with ASC and regulates the activation of NF-κB.34 A homologous protein with identical domain architecture, PYPAF7, also binds ASC, activates caspase-1 and regulates NF-κB dependent transcription.35
Although PYRIN domains occur in more than 20 human proteins, only a few additional PYRIN-domain proteins have been characterized functionally. Almost all of them appear to be involved in apoptosis and inflammation.36., 37., 38., 39., 40. To the best of our knowledge, no mutation analysis is available for any PYRIN domain. Considering that PYRIN-domain proteins interact frequently with other PYRIN-domain proteins, PYRIN/PYRIN interactions are likely an important feature of PYRIN-domain function. Besides the binding between the PYRIN domains of ASC and POP1/ASC2,28 conclusive data on PYRIN/PYRIN interactions come from the zebrafish orthologue of ASC (zAsc) and the caspase Caspy, where the PYRIN domains in both proteins were shown to be required for mutual binding in vitro.41
Here, we present the three-dimensional structure of the PYRIN domain from human ASC. The structure establishes the PYRIN domain fold and corrects previous sequence alignments with other members of the DD superfamily. It suggests a PYRIN/PYRIN interaction mode related to that observed between the CARD domains of Apaf-1 and procaspase-9.12
Section snippets
PYRIN domains belong to the DD superfamily
The structure of the PYRIN domain is composed of six helices that are arranged in the classical DD fold (Figure 1). A search of the Protein Data Bank (PDB) with the program DALI42 yielded the death effector domain (DED) from human FADD2 as the structurally most closely related protein, followed by the procaspase-9 prodomain12 which belongs to the CARD group of proteins, and the tumor necrosis factor receptor-1 (TNFR) death domain.9 All three proteins could be aligned to the PYRIN domain with
Cloning of the ASC PYRIN domain
The ASC PYRIN-domain encoding 272 bp DNA fragment was PCR amplified from Marathon-Ready cDNAs prepared from human lymphocytes (Clontech) using BamHI (ATTCATGGGGCGCGCGCGCGACGCCA) and HindIII (GAATCTACTGGTGCGTGGCCGCCT) oligonucleotide primers designed according to the sequence of the human ASC gene (NCBI protein number BAA87339). PCR cycle conditions were: ten seconds denaturation at 95 °C, 30 seconds annealing at 58 °C, and 1.5 minutes of polymerization at 72 °C. The first one minute
Acknowledgements
This work was supported by the Swedish and Australian Research Councils, and by the Karolinska Institute. G.O. thanks the Australian Research Council for a Federation Fellowship.
References (54)
- et al.
Solution structure of the RAIDD CARD and model for CARD/CARD interaction in caspase-2 and caspase-9 recruitment
Cell
(1998) - et al.
The death domain superfamily: a tale of two interfaces?
Trends Biochem. Sci.
(2001) - et al.
Three-dimensional structure of a complex between the death domains of Pelle and Tube
Cell
(1999) - et al.
The solution structure of FADD death domain—structural basis of death domain interactions of Fas and FADD
J. Biol. Chem.
(1999) - et al.
The three-dimensional solution structure and dynamic properties of the human FADD death domain
J. Mol. Biol.
(2000) - et al.
Solution structure of the tumor necrosis factor receptor-1 death domain
J. Mol. Biol.
(2001) - et al.
ICEBERG: a novel inhibitor of interleukin-1β generation
Cell
(2000) - et al.
The DAPIN family: a novel domain links apoptotic and interferon response proteins
Trends Biochem. Sci.
(2001) - et al.
The PYRIN domain: a possible member of the death domain-fold family implicated in apoptosis and inflammation
Curr. Biol.
(2001) - et al.
PAAD—a new protein domain associated with apoptosis, cancer and autoimmune diseases
Trends Biochem. Sci.
(2001)
Interaction between PYRIN and the apoptotic speck protein (ASC) modulates ASC-induced apoptosis
J. Biol. Chem.
ASC, a novel 22-kDa protein, aggregates during apoptosis of human promyelocytic leukemia HL-60 cells
J. Biol. Chem.
ASC, which is composed of a PYD and a CARD, is up-regulated by inflammation and apoptosis in human neutrophils
Biochem. Biophys. Res. Commun.
PYRIN N-terminal homology domain- and caspase recruitment domain-dependent oligomerization of ASC
Biochem. Biophys. Res. Commun.
The PYRIN-CARD protein ASC is an activating adaptor for caspase-1
J. Biol. Chem.
The inflammasome: a molecular platform triggering activation of inflammatory caspases and processing of proIL-β
Mol. Cell
PYPAF1, a PYRIN-containing Apaf1-like protein that assembles with ASC and regulates activation of NF-κB
J. Biol. Chem.
PYPAF7, a novel PYRIN-containing Apaf1-like protein that regulates activation of NF-κB and caspase-1-dependent cytokine processing
J. Biol. Chem.
A novel PAAD-containing protein that modulates NF-κB induction by cytokines tumor necrosis factor-α and interleukin-1β
J. Biol. Chem.
Functional screening of five PYPAF family members identifies PYPAF5 as a novel regulator of NF-κB and Caspase-1
FEBS Letters
MNDA dimerizes through a complex motif involving an N-terminal basic region
FEBS Letters
Molecular cloning and characterization of DEFCAP-L and -S, two isoforms of a novel member of the mammalian Ced-4 family of apoptosis proteins
J. Biol. Chem.
Caspy, a zebrafish caspase, activated by ASC oligomerization is required for pharyngeal arch development
J. Biol. Chem.
Identification of a basic surface area of the FADD death effector domain critical for apoptotic signaling
FEBS Letters
A docking model of key components of the DISC complex: death domain superfamily interactins redefined
FEBS Letters
Determination of scalar coupling constants by inverse Fourier transformation of in-phase multiplets
J. Magn. Reson.
Torsion angle dynamics for NMR structure calculation with the new program DYANA
J. Mol. Biol.
Cited by (126)
NLRP3 inflammasome pathway, the hidden balance in pregnancy: A comprehensive review
2024, Journal of Reproductive ImmunologyNanoscale organization of the endogenous ASC speck
2023, iScienceMechanics of a molecular mousetrap—nucleation-limited innate immune signaling
2021, Biophysical JournalFrom pyroptosis, apoptosis and necroptosis to PANoptosis: A mechanistic compendium of programmed cell death pathways
2021, Computational and Structural Biotechnology Journal